Молекулярно-генетический анализ полиморфизма микросателлитного локуса FC2054 у собак | Статья в журнале «Молодой ученый»

Отправьте статью сегодня! Журнал выйдет 11 декабря, печатный экземпляр отправим 15 декабря.

Опубликовать статью в журнале

Авторы: ,

Рубрика: Биология

Опубликовано в Молодой учёный №50 (184) декабрь 2017 г.

Дата публикации: 17.12.2017

Статья просмотрена: 215 раз

Библиографическое описание:

Седоусова, С. Д. Молекулярно-генетический анализ полиморфизма микросателлитного локуса FC2054 у собак / С. Д. Седоусова, Е. М. Курак. — Текст : непосредственный // Молодой ученый. — 2017. — № 50 (184). — С. 111-114. — URL: https://moluch.ru/archive/184/47222/ (дата обращения: 30.11.2021).

В настоящей работе охарактеризованы разработанные и апробированные молекулярно-генетические методы анализа полиморфизма микросателлитного локуса FC2054 у собак. Подобраны методы выделения ДНК, оптимальные праймеры для амплификации, определены параметры ПЦР-анализа и электрофореза, позволяющие получать ампликоны различной длины для локуса FC2054.

Ключевые слова: локус, полиморфизм, ампликон


Современные собаки произошли от одомашненных волков и филогенетические данные свидетельствуют о том, что предки собак жили в Восточной Азии около 15 000 лет назад. Через генетический дрейф, вызванный тем, что основатели небольших популяций скрещивались с другими псовыми, образовался широкий фенотипический ряд и, таким образом генетическое разнообразие собак, включающее в себя все известные на сегодняшний день, породы. Собаководство во всем мире осуществляется под эгидой кинологических организаций, в чьи функции входит стандартизация пород собак и обеспечение единства критериев развития и экспертизы породы в разных странах. Каждая из названных кинологических организаций имеет собственный список пород собак, а также собственную классификацию пород [1].

При разведении значительного числа пород собак большое внимание кинологами уделяется чистоте породы. В настоящее время для анализа чистоты пород широко используются традиционные методы, такие как анализ родословных и экстерьерных признаков. Точность такого определения зависит от опыта кинолога и возраста собаки. Из-за этих факторов шанс ошибочного определения породы был достаточно велик [2].

Наряду с классическими методами для идентификации пород собак в последнее время успешно применяются молекулярно-генетические методы.Вкачестве генетических маркеров используются полиморфные последовательности нуклеотидов ДНК, которые позволяют тестировать генетический полиморфизм на уровне генотипа. К таким последовательностям относится микросателлитный локус FC2054 [2, 3].

Целью нашей работы было разработать молекулярно-генетический анализ полиморфизма микросателлитного локуса FC2054 у собак.

Характеристика локусаFH2054.

Для исследования мы выбрали локус FH2054, так как он входит в панель локусов для определения пород собак и имеет достаточно большое число аллелей — 12, количество нуклеотидов в повторе — четыре, размер повтора 90–184 н.п.

Исходя из данных, полученых в GenBank мы описали последовательность нуклеотидов, которая включает тандемный повтор:

1 tcatgttccg cagtgctcta ctcatactac ctcagctgtg atcacataaa atgtggtggg

61tctgtgtccg gaaggctcag ctgggttcat tttcactcat tgtcagtgtt atgaagcact

121tgcttgcctt actcattgca gttagggttg taataaaagc agaaactttg gagctattat

181cggaataagt aacgtcaatc ccatctatct atctatctat ctatctatct atctatcta


301atctatctatctatctatctatctatctatctatctatcttacgactca aacaaacttg

361aaagggaaac tcagcatcta ccacttattg gcagtaaaag ttaggaaag tatttaaccc

Как видно из последовательности нуклеотидов, мотив этого повтора ATCT.

Взятие образцов для исследования

Буккальный эпителий.Животное не следует кормить за два часа до проведения процедуры взятия биоматериала, желательна изоляция от других животных. Стерильную ватную палочку взять за конец, на котором отсутствует ватное покрытие. В течение 10 секунд возвратно-поступательными движениями, вращая ватную палочку, собрать клетки эпителия внутренней стороны щеки, при этом стараясь избегать попадания на палочку большого количества слюны. Ватные палочки оставить до полного высыхания при комнатной температуре (1,5–2 часа), после чего поместить в стерильный пакет с замком (зип-пакет) [4].

Волос. Стерильным пинцетом переносят волос на предметный столик микроскопа для оценки наличия эпителиальных клеток влагалища и волосяной сумки, обращая внимание на присутствие на волосе биологических жидкостей. Волос омывают от поверхностной грязи и возможных контаминантов.

Выделение ДНК.

Выделение ДНК мы осуществляли с использованием СТАВ и ионообменной смолы Chelex 100.

Выделение с использованием ионно-обменной смолы Chelex. Основная процедура выделения включает в себя инкубацию образца с протеиназой К и Chelex 100. Очистку от протеинов и ингибиторов ПЦР проводили путем кипячения образца в присутствии Chelex 100. В качестве образца использовали буккальный эпителий и фрагмент корневой зоны длиной 5–10 мм. Над стерильной 1,5 мл пробиркой, отрезали луковицу волоса с 2–3 мм стержня и вносили 200 мкл 5 % взвеси ионообменной смолы Chelex 100. Далее добавляли 2 мкл протеиназы К (10 мг/мл) и осторожно перемешивали. Инкубировали при температуре +56°C, 8 часов, после чего перемешивали в вортексе в течение 5–10 секунд и центрифугировали на микроцентрифуге 20 секунд при 15000 xg. Пробирку с лизатом инкубировали на кипящей водяной бане в течение 8 минут, после чего перемешивали на вортексе в течение 10 секунд и центрифугируют на микроцентрифуге 3 минуты при 15000 xg. Для постановки реакции ПЦР используют супернатант. Остатки супернатанта хранят при температуре 2–8°C или при –20°C (длительное хранение) [3, 4].

Выделение СТАВ–методом. Образец ткани помещали в центрифужные пробирки, содержащие 500 мкл экстрагирующего буфера (2 % р-р СТАВ; 0,1 М р-р Трис; 1,4 р-р NaCl; 20 мМ р-р трилона Б) и проводили гомогенизацию материала в течение 5 минут. Содержимое пробирок перемешивалось на вихревом смесителе (600 мин-1) в течение 10 сек. Далее пробирки помещались в твердотельный термостат и инкубировать в течение 5 мин при Т = 65°C. После в каждую пробирку добавлялось 400 мкл хлороформа (объемное соотношение 1:1).

Содержимое перемешивалось на горизонтальном шейкере в течение 10 мин. и центрифугировалось при 13000xg в течение 10 мин. По 300 мкл супернатанта переносили в новые пробирки, добавляли 210 мкл изопропилового спирта и перемешивали содержимое на вихревом смесителе. Далее пробирки центрифугировали при 13000xg в течение 10 мин. Супернатант сливался, полученный осадок ДНК промывался 1000 мкл 70 % этанола, охлажденным до температуры Т=–10°C. Содержимое пробирок центрифугировать при 5000xg в течение 5 минут. Процедуру промывки повторялись дважды. После последней промывки супернатант сливался, пробирки размещались в штативе с открытыми крышками. Высушенный осадок растворялся в 50 мкл бидистиллированной и деионизированной воды.

Мы провели выделение ДНК двумя вышеописанными способами. Оценку качества и количества экстрагированной ДНК проводили на основании измерения оптической плотности раствора ДНК в области белкового и нуклеинового спектров поглощения.

Результаты оценки чистоты и концентрации ДНК, выделенной из буккального эпителия и волоса с использованием ионно-обменной смолы Chelex и СТАВ-методом приведены в таблице 1.

Таблица 1

Чистота иконцентрация ДНК, выделенной из биологического материала различными методами

Метод выделения

Биологический материал

буккальный эпителий


Выход ДНК/Чистота из 1 мг образца

Ионообменная смола Chelex

17,61±1,3/ 1,68±0,07

21,37±4,5/ 1,87±0,04


45,65±0,06/ 1,54±0,06

49,72±5,6/ 1,54±0,08

Как видно из таблицы 1, при использовании СТАВ-метода и по чистоте, и по выходу ДНК результаты были примерно одинаковыми для обоих использованных биологических образцов.

Характеризуя выход полученной ДНК необходимо отметить, что наибольшее количество ДНК было получено из обоих биологических образцов при использовании СТАВ-метода.

Анализ чистоты полученной ДНК показал, что наилучшие результаты характерны также для СТАБ метода (буккальный эпителий — 1,54±0,06; волос — 1,54±0,08).

Таким образом, наиболее оптимальным методом по чистоте и концентрации выделенной ДНК является СТАВ-метод, а наиболее подходящим биологическим материалом — буккальный эпителий, так как выделение из него ДНК требует меньше временных и материальных затрат, чем из волоса.

Оптимальные параметры проведения ПЦР иэлектрофореза.

Для анализа полиморфизма мискросателлитного локуса FHC2054 у собак нами была проведена амплификация полученной ДНК с использованием праймеров. Для данного локуса были подобраны и заказаны праймеры следующего состава:



Для исследования были выбраны 2 породы собак (бассет хаунд и чихуахуа) и один метис овчарки.

Полимеразную цепную реакцию проводили на амплификаторе Терцик в объеме 25 мкл. Были установлены оптимальные термопрофили со следующими значениями: 950С — 11 мин; (940С — 30 с, 560С — 30 с, 720С — 60 с) x 30 циклов; 720С — 10 мин.

Ампликоны выявляли с помощью электрофореза в горизонтальной камере SE-1 Helicon в 2 % агарозном геле с последующей окраской бромистым этидием. Электрофорез проводили в течение 45–60 минут. Ампликоны визуализировали облучением полученных гелевых пластин ультрафиолетом на специальных установках. Полученные электрофоретические спектры представлены на рисунке 1.

Рис. 1. Результат электрофореза ампликонов в агарозном геле: образцы 1,2 — ампликоны метиса; 3 — бассет хаунд 1; 4.5 — бассет хаунд 2; 6 — чихуахуа; М — маркер молекулярных масс

Как видно из рисунка 1, для представителей разных пород собак характерны ампликоны различной длины: метис — 100 н.п., бассет хаунд — 90, 110 н.п., чихуахуа — 90 н.п.

Таким образом, в результате молекулярно-генетического анализа локуса FC2054 у трех пород собак нами было выявлено три различных аллеля, характеризующих полиморфизм исследованного локуса.


  1. Зорин, В. Л. Породы собак. Энциклопедия. — М.: Институт кормов для домашних животных, 2006. — 62 с.
  2. Williams J. G. [et al] DNA polymorphisms amplified by arbitrary primers are useful as genetic markers // Nucleic Acids Research. 1990. Vol. № 18 (22). P. 6531–6535.
  3. Altet L., Francino O., Sánchez A. Microsatellite polymorphism in closely related dogs // J. Hered. 2001. Vol 3. P. 276–279.
  4. Методические рекомендации по проведению генетического тестирования животных-компаньонов на основе полимеразной цепной реакции / В. А. Лемеш [и др.]. — Минск: Право и экономика. 2014. 62 с.
Основные термины (генерируются автоматически): порода собак, течение, волос, выделение ДНК, ионообменная смола, полученная ДНК, пробирка, биологический материал, вихревой смеситель, ионно-обменная смола.

Ключевые слова

полиморфизм, локус, ампликон

Похожие статьи

Обзор основных методов обезжелезивания воды

Ионный обмен. — Глубокая степень обезжелезивания; — возможность регенерации загрузочного материала

— наличие в очищаемой воде органического железа приводит к быстрому зарастанию ионообменной смолы.

Опыт применения безмономерной пластмассы «Нолатек» для...

Их выделение становится возможным благодаря процессу проникновения воды в материал с последующим расширением пространства между цепями полимеров [8, с.671].

В течение всего времени лечения у всех пациентов отсутствовали специфические жалобы.

Митохондриальная плазмидоподобная ДНК хлопчатника pGHm2

Это определяется биологической ролью хлоропластов и митохондрий в жизни клетки и организма в целом.

Полученные ДНК обрабатывали рестрикционными эндонуклеазами в соответствующих условиях.

Особенности структуры и сорбционные свойства глауконита...

Природные материалы обладают ионообменными свойствами.

Ионный обмен ионов аммония происходит не только на поверхности глауконита, но и в его поровых пространствах, где расположены менее доступные обменные центры.

Образование продуктов деструкции в аминовых растворах очистки...

Устранение этих негативных факторов является первостепенной задачей, так как они непосредственно влияют на производительность аминной системы и качество получаемой продукции.

- применение ионообменных смол.

Синтез и исследование аминированного гуанидина полиакриламида

Продукт конденсации гуанидина с формальдегидом используют как ионообменная смола.

Слабокислые условия были получены добавлением нескольких капель 1N раствора HCl. Реакция протекает быстро с образованием нерастворимых, непрозрачных, сшитых, белых...

Гибкие автоматизированные модульные комплексы для обработки...

Основное назначение этого модуля — механическая фильтрация в сочетании с попутной обработкой при помощи различных натуральных и композитных материалов.

6) Модуль-колонна ионно-обменной обработки и биологической сорбции

STR-локусы в генетической дактилоскопии Felis catus L.

Так как микросателлитные аллели короткие и вместе с праймерами обычно не превышают 200–300 п.н., то даже сильно поврежденный биологический материал может содержать полные копии исследуемого фрагмента ДНК, обеспечивая их успешную амплификацию.

Похожие статьи

Обзор основных методов обезжелезивания воды

Ионный обмен. — Глубокая степень обезжелезивания; — возможность регенерации загрузочного материала

— наличие в очищаемой воде органического железа приводит к быстрому зарастанию ионообменной смолы.

Опыт применения безмономерной пластмассы «Нолатек» для...

Их выделение становится возможным благодаря процессу проникновения воды в материал с последующим расширением пространства между цепями полимеров [8, с.671].

В течение всего времени лечения у всех пациентов отсутствовали специфические жалобы.

Митохондриальная плазмидоподобная ДНК хлопчатника pGHm2

Это определяется биологической ролью хлоропластов и митохондрий в жизни клетки и организма в целом.

Полученные ДНК обрабатывали рестрикционными эндонуклеазами в соответствующих условиях.

Особенности структуры и сорбционные свойства глауконита...

Природные материалы обладают ионообменными свойствами.

Ионный обмен ионов аммония происходит не только на поверхности глауконита, но и в его поровых пространствах, где расположены менее доступные обменные центры.

Образование продуктов деструкции в аминовых растворах очистки...

Устранение этих негативных факторов является первостепенной задачей, так как они непосредственно влияют на производительность аминной системы и качество получаемой продукции.

- применение ионообменных смол.

Синтез и исследование аминированного гуанидина полиакриламида

Продукт конденсации гуанидина с формальдегидом используют как ионообменная смола.

Слабокислые условия были получены добавлением нескольких капель 1N раствора HCl. Реакция протекает быстро с образованием нерастворимых, непрозрачных, сшитых, белых...

Гибкие автоматизированные модульные комплексы для обработки...

Основное назначение этого модуля — механическая фильтрация в сочетании с попутной обработкой при помощи различных натуральных и композитных материалов.

6) Модуль-колонна ионно-обменной обработки и биологической сорбции

STR-локусы в генетической дактилоскопии Felis catus L.

Так как микросателлитные аллели короткие и вместе с праймерами обычно не превышают 200–300 п.н., то даже сильно поврежденный биологический материал может содержать полные копии исследуемого фрагмента ДНК, обеспечивая их успешную амплификацию.

Задать вопрос