Создание исходного материала в селекции эксклюзивных сортов риса в Казахстане | Статья в журнале «Молодой ученый»

Библиографическое описание:

Рысбекова А. Б., Казкеев Д. Т., Усенбеков Б. Н., Жанбырбаев Е. А., Мошан Б. И., Сартбаева И. А. Создание исходного материала в селекции эксклюзивных сортов риса в Казахстане // Молодой ученый. — 2015. — №9.2. — С. 59-60. — URL https://moluch.ru/archive/89/18477/ (дата обращения: 21.02.2019).

Проведены селекционныеработы по созданию исходного материала риса с окрашенным перикарпом. Получено 607 гибридных зерновок F1 поколений из 43 комбинации, с помощью ПЦР метода проведена идентификация гена Pb, контролирующий признак антоциановой окраски перикарпа риса.

Ключевые слова:черный рис, гибридизация, Pb ген, ПЦР, гибриды.


Breeding work was conducted to create the initial colored rice material. Total 607 number of hybrid kernels of F1 generations were obtained in various 43 combinations. Pb gene, controlling purple pericarp color in rice were identified using PCR method

Keywords:black rice, hybridization, Pb gene, PCR, hybrids.


Рис – вторая по распространенности в мире зерновая культура, посевы которой размещены в 112 странах на площади 145 млн. га, а годовое производство зерна составляет приблизительно 420-500 млн. тонн [1]. В последнее время, в решении проблем старения высокую актуальность приобретает рис с окрашенным перикарпом или «черный рис». В черном рисе содержится растительные волокна, которые предотвращает заболевание раком и проблемы сердечно-сосудистой системы [2, 3]. В образцах отрубей черного риса обнаружены большое количество антиоксидантов, которые предотвращает повреждение ДНК, поглощать вредные молекулы в организме и замедлить старение человеческого организма. Черный рис содержит все витамины группы В, Е, РР, микроэлементы – калий, магний, фосфор, цинк, марганец [4]. Импортируемый рис с окрашенным перикарпом, в частности «черный рис» в 5-6 раз дороже обычного риса, что делает его недоступным для широких слоев населения. Селекция по данному направлению в Казахстане до сих пор не проводилась. Целью работы является создание исходных форм риса с окрашенным перикарпом для селекции отечественных сортов.

Создание изменчивости путем скрещивания является одним из главных методов в селекции. В оранжерее ИББР пневмокастрацией и ТВЕЛ методом опыления проведена гибридизация генотипов риса с окрашенным перикарпом. При подборе родительских пар в качестве материнской формы использовали образцы цветного риса (Рубин, Мавр, Черный рис и т.д.). В качестве отцовской формы использовали местные, адаптированные к почвенно-климатическим условиям рисосеющих регионов Казахстана белозерные сорта отечественной селекции Мадина, Маржан, Баканасский, Пак Ли и российские сорта. В результате гибридизации получено 607 гибридных зерновок F1 поколений из 43 комбинации. Завязываемость в среднем составило 30,1%. По комбинационной способности наибольшей завязываемостью гибридных зерновок наблюдалась при комбинациях ♀б/н Италия × ♂Курчанка и ♀Мавр × ♂Арборио (72 и 71% соответственно). Средним показателем завязываемости характеризовались комбинации ♀Черный рис × ♂Мадина (37%) и ♀Мавр × ♂Мадина (34%).

Для определения генетического отличия по аллелю гена Pb у белозерных образцов и образцов риса с антоциановым перикарпом проводили ПЦР в F1 гибридах в сравнении с родительскими формами. Антоциановая окраска перикарпа у риса является доминантным признаком и проявляется в период полного созревания зерновок, контролируется двумя комплементарными генами PURPLEPERICARPA(Pp, Prpa, Prp1) и PURPLEPERICARPB (Pb, Prpb, Prp2). Ген Ppлокализован в 1-ой хромосоме, ген Pbв 4-ой хромосоме [5]. Анализ сиквенса ДНК показал, что отличие риса с антоциановой окраской от белого риса является в делеции 2 пар оснований (GT), тогда как у белого риса обнаружено инсерция 2 п.о. (GT) [6]. Были использованы праймеры со следующей нуклеотидной последовательностью: F 5’-GGGAGAAGCTCAACGAGATG; R 5’-GGGTGGCAGATTCATCACTT [7]. Результаты анализа показало, что размер ПЦР-продукта у белозерных генотипов (Анаит; Баканасский; Ақдала) с GT вставкой составляет 1200 п.о. У образцов с антоциановой окраской с GT делецией BamH1 рестриктаза разрезает ПЦР продукт на две фрагменты 700 и 500 п.о. (рисунок 1).

Белозерные: 1-Анаит; 2-Баканасский; 3-Ақдала; С антоциановой окраской: 4-Мавр; 5-Черный рис, Китай; 6-Черный рис, Филиппины; 7- F1 ♀Черный рис × ♂Анаит; 8- F1 ♀Мавр × ♂Пак Ли; 9- F1 ♀Мавр × ♂Баканасский; 10-HB-1, black rice.


Рис. 1 – Идентификация Pb гена у образцов риса контрастных по окраске перикарпа

На рисунке видно, что гибриды F1 ♀Черный рис × ♂Анаит; F1 ♀Мавр × ♂Пак Ли; F1 ♀Мавр×♂Баканасский являются настоящими гибридами, поскольку у них присутствуют фрагменты материнской (700 и 500 п.о.), а также слабо выраженный отцовской (1200 п.о.) формы.

Таким образом, в результате гибридизации из 43 комбинации получено 607 гибридных зерновок F1 поколений. Проведена идентификация Pb аллеля у белозерных образцов и образцов с антоциановой окраской. Идентифицированы «настоящие» гибриды F1 поколении. Созданный исходный материал будет вовлекаться в дальнейшую селекцию по созданию отечественного сорта риса с окрашенным перикарпом.

Работа выполнена в рамках проекта 0562/ГФ3 «Биотехнология получения первых казахстанских форм и линий риса с окрашенным перикарпом как исходного материала в селекции эксклюзивных отечественных сортов».



1.             Э.Ю. Папулова, С.С. Костина. Оценк исходного материала риса для создания сортов с повышенным содержанием амилозы // Зерновое хозяйство России. - 2011.- №1 (13) - С. 10-13.

2.             Sompong R., Siebenhandl-Ehn S., Linsberger-Martin G., Berghofer E. Physicochemical and antioxidative properties of red and black rice varieties from Thailand, China and Sri Lanka // Food Chemistry. - 2011. - 124. - Р.132-140.

3.             Black rice is the new cancer-fighting superfood, claim scientists: http://www.dailymail.co.uk/health/article-1306356/Black-rice-new-cancer-fighting-superfood-claim-scientists.html#ixzz2h1ijg5hL

4.             Лоточникова Т.Н., Остапенко Н.В., Лоточников С.В., Зеленский Г.Л., Гончарова Ю.К., Рубан В.Я. Качество новых сортов селекции ВНИИ риса / Материалы международной научно-практической конференции «Научно-инновационные основы развития рисоводства в Казахстане и странах зарубежья». Кызылорда, 2012. - С.102-105.

5.             Md Mominur Rahman et. al., The Genetic Constitutions of Complementary Genes Pp and Pb Determine the Purple Color Variation in Pericarps with Cyanidin-3-O-glucoside Depositions in Black Rice // J. Plant Biol. - 2013. - 56:24-31.

6.             Wang C, Shu Q. Fine mapping and candidate gene analysis of purple pericarp gene Pb in rice (Oryza sativa L.) // Chinese Sci Bull. - 2007. - 52:3097-3104.

7.             Md Mominur Rahman et. al., The Genetic Constitutions of Complementary Genes Pp and Pb Determine the Purple Color Variation in Pericarps with Cyanidin-3-O-glucoside Depositions in Black Rice // J. Plant Biol. - 2013. - 56:24-31.

Основные термины (генерируются автоматически): Черный рис, PCR, Пак Ли, результат гибридизации, Мавр, белый рис, PURPLEPERICARPB, PURPLEPERICARPA, GGGTGGCAGATTCATCACTT, GGGAGAAGCTCAACGAGATG.

Ключевые слова

ПЦР, гибриды, гибридизация, черный рис, Pb ген

Похожие статьи

Создание новых резистентных форм Oryza sativa l. к Magnaporthe...

При гибридизации растений использовали пневмокастрацию материнских форм и опыление «ТВЕЛЛ» — методом [2].

Рис. 3. ПЦР на ген устойчивости к пирикуляриозу Pi-b.

Практическое значение синестезии на примере программы the vOICe

Рис. 2. Линия вниз. Рис. 3. Набор вертикальных полос. Рис. 4. Два квадрата.

Рис. 10. Схема комнаты, использовавшейся на втором этапе исследования. Результаты были таковы.

Мессенджеры как актуальный канал маркетингового продвижения

2. Вотс Апп (рис. 2). Рис. 2. Логотип WhatsApp. К особенностям такого типа общения относятся

Приобрести базу и затем просто отправлять спамы не получится. Такие рассылки автоматически отправляются в черный список.

Итоги маркер-ассоциированного отбора и картирование QTL...

Результаты исследований. В 2014 г. по результатам изучения картирующей популяции ITMI в гибридизацию с местным селекционным материалом (Альбидум 653) включены линии 31, 42, 58, 59, 60, 80, 94.

Рис. 3. Праймер Xgwm 295 (Opata -254 bp, Synth – 258 bp).

Применение гаплоидной технологии для ускорения селекции...

Работа посвящена созданию низкоамилозного исходного материала для селекции отечественных глютинозных сортов риса с применением современных методов селекции. В результате проведенных работ получены перспективные дигаплоидные линии различных...

Программно-аппаратный комплекс регистрации пользователей...

Зная SSID сети, клиент может выяснить, возможно ли подключение к данной точке доступа.

Рис. 4. Диаграмма развертывания. Выводы. В данной статье была рассмотрена и описана архитектура программно-аппаратного комплекса регистрации пользователей открытой WiFi...

Распознавание английского текста сверточной нейронной сетью

Каждый пиксель кодируется числом в интервале , где 0 соответствует черному цвету, а 1 – белому (рис. 1).

Рис. 6. Пример работы нейронной сети для одной буквы с искажениями (верхние буквы – исходные изображения, нижние – результат работы сети).


Социальные комментарии Cackle

Похожие статьи

Создание новых резистентных форм Oryza sativa l. к Magnaporthe...

При гибридизации растений использовали пневмокастрацию материнских форм и опыление «ТВЕЛЛ» — методом [2].

Рис. 3. ПЦР на ген устойчивости к пирикуляриозу Pi-b.

Практическое значение синестезии на примере программы the vOICe

Рис. 2. Линия вниз. Рис. 3. Набор вертикальных полос. Рис. 4. Два квадрата.

Рис. 10. Схема комнаты, использовавшейся на втором этапе исследования. Результаты были таковы.

Мессенджеры как актуальный канал маркетингового продвижения

2. Вотс Апп (рис. 2). Рис. 2. Логотип WhatsApp. К особенностям такого типа общения относятся

Приобрести базу и затем просто отправлять спамы не получится. Такие рассылки автоматически отправляются в черный список.

Итоги маркер-ассоциированного отбора и картирование QTL...

Результаты исследований. В 2014 г. по результатам изучения картирующей популяции ITMI в гибридизацию с местным селекционным материалом (Альбидум 653) включены линии 31, 42, 58, 59, 60, 80, 94.

Рис. 3. Праймер Xgwm 295 (Opata -254 bp, Synth – 258 bp).

Применение гаплоидной технологии для ускорения селекции...

Работа посвящена созданию низкоамилозного исходного материала для селекции отечественных глютинозных сортов риса с применением современных методов селекции. В результате проведенных работ получены перспективные дигаплоидные линии различных...

Программно-аппаратный комплекс регистрации пользователей...

Зная SSID сети, клиент может выяснить, возможно ли подключение к данной точке доступа.

Рис. 4. Диаграмма развертывания. Выводы. В данной статье была рассмотрена и описана архитектура программно-аппаратного комплекса регистрации пользователей открытой WiFi...

Распознавание английского текста сверточной нейронной сетью

Каждый пиксель кодируется числом в интервале , где 0 соответствует черному цвету, а 1 – белому (рис. 1).

Рис. 6. Пример работы нейронной сети для одной буквы с искажениями (верхние буквы – исходные изображения, нижние – результат работы сети).

Задать вопрос