Роль полиморфных вариантов гена глутатионпероксидазы-1 в формировании предрасположенности к профессиональному хроническому бронхиту | Статья в журнале «Молодой ученый»

Библиографическое описание:

Гнездилова И. В., Ахмадишина Л. Роль полиморфных вариантов гена глутатионпероксидазы-1 в формировании предрасположенности к профессиональному хроническому бронхиту // Молодой ученый. — 2010. — №1-2. Т. 1. — С. 126-129. — URL https://moluch.ru/archive/13/1211/ (дата обращения: 25.06.2018).

Хронический обструктивный бронхит – это заболевание, характеризующееся хроническим воспалением бронхов, ведущее к прогрессирующему нарушению вентиляции по обструктивному типу и проявляющееся кашлем, одышкой и выделением мокроты[4] .Хронический бронхит является классическим примером многофакторного заболевания, в реализации которого, наряду с внешнесредовыми факторами, существенную роль играет генетическая компонента[7].Важное значение в защите легких от токсичных продуктов, содержащихся в табачном дыме, атмосфере крупных промышленных городов и воздухе вредных производств, играют ферменты системы биотрансформации ксенобиотиков и антиоксидантной защиты[5]. Нами был проанализирован полиморфный локус Pro197Leu гена глутатионпероксидазы-1.

Ключевые слова: профессиональный хронический бронхит, глутатионпероксидаза-1, генотип.

Введение. Хронические заболевания органов дыхания являются серьёзной проблемой современной медицины, что обусловлено широким распространением указанной патологии, высокими показателями инвалидности и смертности населения[3]. Традиционно основными факторами риска развития хронического бронхита считается воздействие производственной пыли и токсических веществ, а также курение[9]. Хронический обструктивный бронхит формируется примерно у 4-25% лиц, работающих во вредных и неблагоприятных производственных условиях[2]. В связи с этим, особую значимость представляет изучение профессионального хронического бронхита. Несмотря на огромное внимание, которое уделяется хроническому обструктивному бронхиту, меры эффективной его профилактики разработаны недостаточно, что затрудняет прогнозирование индивидуальной предрасположенности, тяжести течения и исхода заболевания. Таким образом, поиск информативных генетических маркеров, контролирующих ключевые звенья патогенеза хронического обструктивного бронхита, несомненно, является одной из актуальных и перспективных задач медицинской генетики[1]. Исследования последних лет показывают, что ключевую роль в патогенезе многих заболеваний легких играет свободнорадикальное окисление[6]. Легкие наиболее уязвимы в отношении оксидативного повреждения, так как непосредственно подвергаются действию кислорода, а также оксидантов, содержащихся в загрязненном воздухе. При этом большое значение имеет образование активных форм кислорода в результате дисбаланса в системе «оксиданты – антиоксиданты»[10], что, по существу, является пусковым механизмом повреждения бронхов и развития хронического обструктивного бронхита[11]. В этой связи, несомненно, что изучение генов, контролирующих активность ферментов антиоксидантной защиты является важной задачей при исследовании предрасположенности к заболеваниям дыхательной системы, вызванных действием производственных факторов и сигаретного дыма.

Материалы и методы. В работе использованы образцы ДНК 122 больных с профессиональным хроническим бронхитом, из которых 85 человек (69,67%) страдали пылевым и 37 (30,33%) – токсико-пылевым бронхитом.

В качестве группы сравнения были обследованы 166 высокостажированных здоровых рабочих Учалинского горно-обогатительного комбината.

Выделение ДНК. Материалом для молекулярно-генетического анализа служили образцы ДНК, выделенные из лимфоцитов периферической венозной крови. Для выделения ДНК использовался стандартный метод фенольно-хлороформной экстракции с небольшими модификациями (микрометод) [9]. Раствор ДНК хранили при температуре ‑20°С.

Проведение полимеразной цепной реакции синтеза ДНК и рестрикционного анализа. Анализ полиморфного локуса Pro197Leu гена GPX-1 проводили методом полимеразной цепной реакции синтеза ДНК (ПЦР) на термоциклере «Терцик» производства компании “ДНК-технология” в автоматическом режиме в стандартных условиях с использованием ДНК-полимеразы Thermus aquaticus ("Сибэнзим", Россия). Перечень исследованных локусов, последовательности локусспецифических олигонуклеотидных праймеров, а также номенклатура аллелей представлены в табл. 1.1. Полиморфизм локуса ген GPX-1 исследовали методом полиморфизма длин рестрикционных фрагментов (ПДРФ).

Таблица 1.1 Тип полиморфизма, последовательности праймеров, ферменты рестрикции и номенклатура аллелей полиморфных ДНК-локусов.

 

Полиморфный локус гена

Праймеры (5’→3’)

t° C   отжига

 

Длина продукта, пн

Рестриктаза

Литературный

источник

1

C593T

 

(Pro197Leu)

GPX-1

GCCTGGTGGTGGGTTCGAGCC

GACAGCAGCACTGCAACTGCC

69

359

BstDEI

Forsberg L. et al., 1999

 

Проведение электрофореза и визуализация результатов. Амплифицированные фрагменты ДНК разделяли электрофоретически в 7-8%-ном полиакриламидном неденатурированном геле (ПААГ). После окончания электрофореза гель окрашивали раствором бромистого этидия (0,1мкг/мл) в течение 10 минут и анализировали в проходящем ультрафиолетовом свете на трансиллюминаторе. Размеры аллелей определяли путем сравнения с маркером, шаг которого равнялся 100 пн.

            Статистический анализ. Математическую обработку результатов исследования проводили с использованием пакетов статистических программ: Statistica 6.0, Microsoft Access, BIOSTAT (Primer of Biostatistics version 4.03).

            Результаты и обсуждение. В группе больных профессиональным бронхитом и здоровых рабочих нами был проанализирован полиморфный локус Pro197Leu гена глутатионпероксидазы 1 (GPX-1) (табл.1.2). Сравнение общей выборки больных профессиональным бронхитом и здоровых индивидов показало сходство в распределении частот генотипов и аллелей локуса Pro197Leu гена GPX-1 (χ2=3.39, df=2, р=0.18 и χ 2=0.68, df=1, р=0.41, соответственно). Сравнительный анализ в указанных группах с учетом этнической принадлежности респондентов статистически достоверных различий не выявил.

GPX, наряду с каталазой является важным компонентом антиоксидантной защиты не только лёгких, но и всего организма в целом, поскольку участвует в разрушении перекиси водорода и окисленных липидов. В организме человека представлено 5 форм GPX. Вероятно, GPX-1, которая является классической глутатионпероксидазой, не принимает участия в патогенезе заболеваний органов дыхания, глутатионпероксидаза-3 (GPX-3), напротив, является собственно лёгочной [8]. Таким образом, целесообразным в дальнейшем представляется изучение именно GPX-3.

 

 

 

 

 

Таблица 1.2Распределение частот генотипов и аллелей полиморфного локуса Pro197Leu гена GPX1 у больных профессиональным хроническим бронхитом и здоровых рабочих

Группа

 

Генотипы

N1

Аллели

N2

ni.

 pi±sp. CI %

ni.

 pi±sp. CI %

Pro/Pro

Pro/Leu

Leu/Leu

 

Pro

Leu

 

Профессиональный бронхит

 

Всего

55

45.45±4.53

(36.38-54.76)

65

53.72±4.53

(44.43-62.83)

1

0.83±0.83

(0.02-4.52)

121

175

72.31±2.88

(66.23-77.85)

67

27.69±2.88

(22.15-33.78)

242

Русские

 

22

50.00±7.54

(34.56-65.44)

21

47.73±7.53

(32.4663.31)

1

2.27±2.25

(0.06-12.02)

44

65

73.86±4.68

(63.41-82.66)

23

26.14±4.68

(17.34-36.59)

88

Татары

 

23

42.59±6.73

(29.23-56.79)

31

57.41±6.73

(43.21-70.77)

-

54

77

71.30±4.35

(61.80-79.59)

31

28.70±4.35

(20.41-38.20)

108

Башкиры

 

10

43.48±10.34

(23.19-65.51)

13

56.52±10.34

(34.49-76.81)

-

23

33

71.74±6.64

(56.54-84.01)

13

28.26±6.64

(15.99-43.46)

46

Здоровые рабочие

Всего

65

41.94±3.96

(34.07-50.12)

83

53.55±4.01

(45.37-61.59)

7

4.52±1.67

(1.83-9.08)

155

213

68.71±2.63

(63.23-73.83)

97

31.29±2.63

(26.17-36.77)

310

Русские

 

29

36.71±5.42

(26.14-48.31)

45

56.96±5.57

(45.33-68.06)

5

6.33±2.74

(2.09-14.16)

79

103

65.19±3.79

(57.21-72.58)

55

34.81±3.79

(27.42-42.79)

158

Татары

 

18

54.55±8.67

(36.35-71.89)

15

45.45±8.67

(28.11-63.65)

-

33

51

77.27±5.16

(56.30-86.69)

15

22.73±5.16

(13.31-34.70)

66

Башкиры

 

18

41.86±7.52

(27.01-57.87)

23

53.49±7.61

(37.65-68.82)

2

4.65±3.21

(0.57-15.81)

43

59

68.60±5.00

(57.70-78.19)

27

31.40±5.00

(21.82-42.30)

84

 

ЛИТЕРАТУРА:

            1.Гичев Ю.П. //Загрязнение окружающей среды и здоровье человека (Печальный опыт России) , Новосибирск, СО РАМН. - 2002. – 230 с.

            2.Лещенко И.В., Овчаренко С.И, Шмелёв Е.И.// Хроническая обструктивная болезнь. Руководство для врачей/ Федеральная программа.- М.: 2004.-62 с.

3.Чучалин А.Г.// Хронические обструктивные болезни легких. - М.: БИНОМ. – 1999. - 512 c.

            4.Шмелёв Е.И. Хронический обструктивный бронхит // Хроническая обструктивная болезнь лёгких / Под ред. А.Г. Чучалина . М . -1998.- С. 402.

       5.Baranov V.S., Ivaschenko T., Bakay B. et al. Proportion of the GSTM1 0/0 genotipe in some Slavic populations and its correlation with cystic fibrosis and some multifactorial diseases // Hum.Genet.- 1996.- Vol.97. P.516-520.

            6. Bastaki M., Huen K., Manzanillo P., Chande N., Chen C., Balmes J.R., Tager I.B., Holland N. Genotype-activity relationship for Mn-superoxide dismutase, glutathione peroxidase 1 and catalase in humans//Pharmacogenet Genomics. -2006.- Vol.16(4).- P. 279-86.

7. Christiani D.C. Occupation and COPD // Occup. Environ. Med.- 2005.- Vol.62. P. 215.

            8.Kinnula V.L. Focus on antioxidant enzymes and antioxidant strategies in smoking related airway disease // Thorax.- 2005.- Vol. 60. P. 693-700.

            9.Mathew C.C. The isolation of high molecular weight eucariotic DNA // Methods in Molecular Biology. Ed. Walker J.M.. - N.Y., L.: Human Press. - 1984. - Vol. 2. - p. 31.

10.Nadif R., Mintz M., Jedlicka A., Bertrand J.P., Kleeberger S.R., Kauffmann F. Association of CAT polymorphisms with catalase activity and exposure to environmental oxidative stimuli//Free Radic Res.-2005.- Vol. 39(12). P.1345-50.

11.Forsberg L., Lyrenas L., de Faire U., Morgenstern R. A common functional C-T substitution polymorphism in the promoter region of the human catalase gene influences transcription factor binding, reporter gene transcription and is correlated to blood catalase levels// Free Radical Biology and Medicine.- 2001.- Vol.30.- №5.-P. 500-505.

 

Основные термины (генерируются автоматически): Хронический обструктивный бронхит, полиморфный локус, профессиональный хронический бронхит, GPX, профессиональный бронхит, Хроническая обструктивная болезнь, антиоксидантная защита, хронический бронхит, цепная реакция синтеза ДНК, BIOSTAT.


Похожие статьи

Особенности повышенного риска развития хронического...

В Узбекистане хронический обструктивный бронхит (ХОБЛ), в структуре хронической обструктивной болезни легких (ХОБЛ) составляет 70 — 85 %.

Прогностическое значение биомаркеров в оценке эффективности...

Прогностическое значение биомаркеров в оценке эффективности терапии хронической обструктивной болезни легких (обзор литературы). Будневский Андрей Валериевич, доктор медицинских наук, профессор. Овсянников Евгений Сергеевич, кандидат медицинских наук.

Биомаркеры как предикторы исходов хронической...

Хроническая обструктивная болезнь легких (ХОБЛ) на сегодняшний день продолжает занимать лидирующие позиции среди основных причин заболеваемости и смертности [1, 2–5]. Учитывая общее постарение населения, непрекращающееся действие факторов риска...

К вопросу о системных проявлениях хронической обструктивной...

Хроническая обструктивная болезнь легких в силу своей высокой распространенности, тяжести течения, неуклонного прогрессирования имеет большое социальное и экономическое значение [1, 2, 4, 6–9].

Распределение больных хронической обструктивной болезнью...

Хронической обструктивной болезнь лёгких мужчины.

хронической обструктивной болезни легких. Длительность. артериальной гипертензии.

Профилактика обострений хронической обструктивной болезни...

Профилактика обострений хронической обструктивной болезни легких: роль компонентов пульмонологической реабилитации. Кожевникова Светлана Алексеевна, кандидат медицинских наук, ассистент; Будневский Андрей Валериевич, доктор медицинских наук, профессор...

Особенности распространенности и структура аритмий у больных...

Хроническая обструктивная болезнь легких (ХОБЛ) является одной из ведущих причин заболеваемости и смертности в мире [1]. Установлено, что данное заболевание приводит к ухудшению качества жизни [2]. В настоящее время хорошо изучены системные эффекты при...

Иммунологические аспекты при патологии легких

Хроническая обструктивная болезнь легких (ХОБЛ) – распространенное заболевание во всем мире, являющееся одной из основных причин нетрудоспособности, инвалидности, значительно снижающее качество жизни пациентов ХОБЛ.

Изучение состояния гуморального иммунитета при хронической...

Ключевые слова: хроническая обструктивная болезнь легких, иммуноглобулины, индекс курения, IgA, IgE. Хроническая обструктивная болезнь легких (ХОБЛ) представляет серьезную проблему как социального, так и экономического характера.

Обсуждение

Социальные комментарии Cackle

Похожие статьи

Особенности повышенного риска развития хронического...

В Узбекистане хронический обструктивный бронхит (ХОБЛ), в структуре хронической обструктивной болезни легких (ХОБЛ) составляет 70 — 85 %.

Прогностическое значение биомаркеров в оценке эффективности...

Прогностическое значение биомаркеров в оценке эффективности терапии хронической обструктивной болезни легких (обзор литературы). Будневский Андрей Валериевич, доктор медицинских наук, профессор. Овсянников Евгений Сергеевич, кандидат медицинских наук.

Биомаркеры как предикторы исходов хронической...

Хроническая обструктивная болезнь легких (ХОБЛ) на сегодняшний день продолжает занимать лидирующие позиции среди основных причин заболеваемости и смертности [1, 2–5]. Учитывая общее постарение населения, непрекращающееся действие факторов риска...

К вопросу о системных проявлениях хронической обструктивной...

Хроническая обструктивная болезнь легких в силу своей высокой распространенности, тяжести течения, неуклонного прогрессирования имеет большое социальное и экономическое значение [1, 2, 4, 6–9].

Распределение больных хронической обструктивной болезнью...

Хронической обструктивной болезнь лёгких мужчины.

хронической обструктивной болезни легких. Длительность. артериальной гипертензии.

Профилактика обострений хронической обструктивной болезни...

Профилактика обострений хронической обструктивной болезни легких: роль компонентов пульмонологической реабилитации. Кожевникова Светлана Алексеевна, кандидат медицинских наук, ассистент; Будневский Андрей Валериевич, доктор медицинских наук, профессор...

Особенности распространенности и структура аритмий у больных...

Хроническая обструктивная болезнь легких (ХОБЛ) является одной из ведущих причин заболеваемости и смертности в мире [1]. Установлено, что данное заболевание приводит к ухудшению качества жизни [2]. В настоящее время хорошо изучены системные эффекты при...

Иммунологические аспекты при патологии легких

Хроническая обструктивная болезнь легких (ХОБЛ) – распространенное заболевание во всем мире, являющееся одной из основных причин нетрудоспособности, инвалидности, значительно снижающее качество жизни пациентов ХОБЛ.

Изучение состояния гуморального иммунитета при хронической...

Ключевые слова: хроническая обструктивная болезнь легких, иммуноглобулины, индекс курения, IgA, IgE. Хроническая обструктивная болезнь легких (ХОБЛ) представляет серьезную проблему как социального, так и экономического характера.

Задать вопрос