Библиографическое описание:

Гнездилова И. В., Ахмадишина Л. Роль полиморфных вариантов гена глутатионпероксидазы-1 в формировании предрасположенности к профессиональному хроническому бронхиту // Молодой ученый. — 2010. — №1-2. Т. 1. — С. 126-129.

Хронический обструктивный бронхит – это заболевание, характеризующееся хроническим воспалением бронхов, ведущее к прогрессирующему нарушению вентиляции по обструктивному типу и проявляющееся кашлем, одышкой и выделением мокроты[4] .Хронический бронхит является классическим примером многофакторного заболевания, в реализации которого, наряду с внешнесредовыми факторами, существенную роль играет генетическая компонента[7].Важное значение в защите легких от токсичных продуктов, содержащихся в табачном дыме, атмосфере крупных промышленных городов и воздухе вредных производств, играют ферменты системы биотрансформации ксенобиотиков и антиоксидантной защиты[5]. Нами был проанализирован полиморфный локус Pro197Leu гена глутатионпероксидазы-1.

Ключевые слова: профессиональный хронический бронхит, глутатионпероксидаза-1, генотип.

Введение. Хронические заболевания органов дыхания являются серьёзной проблемой современной медицины, что обусловлено широким распространением указанной патологии, высокими показателями инвалидности и смертности населения[3]. Традиционно основными факторами риска развития хронического бронхита считается воздействие производственной пыли и токсических веществ, а также курение[9]. Хронический обструктивный бронхит формируется примерно у 4-25% лиц, работающих во вредных и неблагоприятных производственных условиях[2]. В связи с этим, особую значимость представляет изучение профессионального хронического бронхита. Несмотря на огромное внимание, которое уделяется хроническому обструктивному бронхиту, меры эффективной его профилактики разработаны недостаточно, что затрудняет прогнозирование индивидуальной предрасположенности, тяжести течения и исхода заболевания. Таким образом, поиск информативных генетических маркеров, контролирующих ключевые звенья патогенеза хронического обструктивного бронхита, несомненно, является одной из актуальных и перспективных задач медицинской генетики[1]. Исследования последних лет показывают, что ключевую роль в патогенезе многих заболеваний легких играет свободнорадикальное окисление[6]. Легкие наиболее уязвимы в отношении оксидативного повреждения, так как непосредственно подвергаются действию кислорода, а также оксидантов, содержащихся в загрязненном воздухе. При этом большое значение имеет образование активных форм кислорода в результате дисбаланса в системе «оксиданты – антиоксиданты»[10], что, по существу, является пусковым механизмом повреждения бронхов и развития хронического обструктивного бронхита[11]. В этой связи, несомненно, что изучение генов, контролирующих активность ферментов антиоксидантной защиты является важной задачей при исследовании предрасположенности к заболеваниям дыхательной системы, вызванных действием производственных факторов и сигаретного дыма.

Материалы и методы. В работе использованы образцы ДНК 122 больных с профессиональным хроническим бронхитом, из которых 85 человек (69,67%) страдали пылевым и 37 (30,33%) – токсико-пылевым бронхитом.

В качестве группы сравнения были обследованы 166 высокостажированных здоровых рабочих Учалинского горно-обогатительного комбината.

Выделение ДНК. Материалом для молекулярно-генетического анализа служили образцы ДНК, выделенные из лимфоцитов периферической венозной крови. Для выделения ДНК использовался стандартный метод фенольно-хлороформной экстракции с небольшими модификациями (микрометод) [9]. Раствор ДНК хранили при температуре ‑20°С.

Проведение полимеразной цепной реакции синтеза ДНК и рестрикционного анализа. Анализ полиморфного локуса Pro197Leu гена GPX-1 проводили методом полимеразной цепной реакции синтеза ДНК (ПЦР) на термоциклере «Терцик» производства компании “ДНК-технология” в автоматическом режиме в стандартных условиях с использованием ДНК-полимеразы Thermus aquaticus ("Сибэнзим", Россия). Перечень исследованных локусов, последовательности локусспецифических олигонуклеотидных праймеров, а также номенклатура аллелей представлены в табл. 1.1. Полиморфизм локуса ген GPX-1 исследовали методом полиморфизма длин рестрикционных фрагментов (ПДРФ).

Таблица 1.1 Тип полиморфизма, последовательности праймеров, ферменты рестрикции и номенклатура аллелей полиморфных ДНК-локусов.

 

Полиморфный локус гена

Праймеры (5’→3’)

t° C   отжига

 

Длина продукта, пн

Рестриктаза

Литературный

источник

1

C593T

 

(Pro197Leu)

GPX-1

GCCTGGTGGTGGGTTCGAGCC

GACAGCAGCACTGCAACTGCC

69

359

BstDEI

Forsberg L. et al., 1999

 

Проведение электрофореза и визуализация результатов. Амплифицированные фрагменты ДНК разделяли электрофоретически в 7-8%-ном полиакриламидном неденатурированном геле (ПААГ). После окончания электрофореза гель окрашивали раствором бромистого этидия (0,1мкг/мл) в течение 10 минут и анализировали в проходящем ультрафиолетовом свете на трансиллюминаторе. Размеры аллелей определяли путем сравнения с маркером, шаг которого равнялся 100 пн.

            Статистический анализ. Математическую обработку результатов исследования проводили с использованием пакетов статистических программ: Statistica 6.0, Microsoft Access, BIOSTAT (Primer of Biostatistics version 4.03).

            Результаты и обсуждение. В группе больных профессиональным бронхитом и здоровых рабочих нами был проанализирован полиморфный локус Pro197Leu гена глутатионпероксидазы 1 (GPX-1) (табл.1.2). Сравнение общей выборки больных профессиональным бронхитом и здоровых индивидов показало сходство в распределении частот генотипов и аллелей локуса Pro197Leu гена GPX-1 (χ2=3.39, df=2, р=0.18 и χ 2=0.68, df=1, р=0.41, соответственно). Сравнительный анализ в указанных группах с учетом этнической принадлежности респондентов статистически достоверных различий не выявил.

GPX, наряду с каталазой является важным компонентом антиоксидантной защиты не только лёгких, но и всего организма в целом, поскольку участвует в разрушении перекиси водорода и окисленных липидов. В организме человека представлено 5 форм GPX. Вероятно, GPX-1, которая является классической глутатионпероксидазой, не принимает участия в патогенезе заболеваний органов дыхания, глутатионпероксидаза-3 (GPX-3), напротив, является собственно лёгочной [8]. Таким образом, целесообразным в дальнейшем представляется изучение именно GPX-3.

 

 

 

 

 

Таблица 1.2Распределение частот генотипов и аллелей полиморфного локуса Pro197Leu гена GPX1 у больных профессиональным хроническим бронхитом и здоровых рабочих

Группа

 

Генотипы

N1

Аллели

N2

ni.

 pi±sp. CI %

ni.

 pi±sp. CI %

Pro/Pro

Pro/Leu

Leu/Leu

 

Pro

Leu

 

Профессиональный бронхит

 

Всего

55

45.45±4.53

(36.38-54.76)

65

53.72±4.53

(44.43-62.83)

1

0.83±0.83

(0.02-4.52)

121

175

72.31±2.88

(66.23-77.85)

67

27.69±2.88

(22.15-33.78)

242

Русские

 

22

50.00±7.54

(34.56-65.44)

21

47.73±7.53

(32.4663.31)

1

2.27±2.25

(0.06-12.02)

44

65

73.86±4.68

(63.41-82.66)

23

26.14±4.68

(17.34-36.59)

88

Татары

 

23

42.59±6.73

(29.23-56.79)

31

57.41±6.73

(43.21-70.77)

-

54

77

71.30±4.35

(61.80-79.59)

31

28.70±4.35

(20.41-38.20)

108

Башкиры

 

10

43.48±10.34

(23.19-65.51)

13

56.52±10.34

(34.49-76.81)

-

23

33

71.74±6.64

(56.54-84.01)

13

28.26±6.64

(15.99-43.46)

46

Здоровые рабочие

Всего

65

41.94±3.96

(34.07-50.12)

83

53.55±4.01

(45.37-61.59)

7

4.52±1.67

(1.83-9.08)

155

213

68.71±2.63

(63.23-73.83)

97

31.29±2.63

(26.17-36.77)

310

Русские

 

29

36.71±5.42

(26.14-48.31)

45

56.96±5.57

(45.33-68.06)

5

6.33±2.74

(2.09-14.16)

79

103

65.19±3.79

(57.21-72.58)

55

34.81±3.79

(27.42-42.79)

158

Татары

 

18

54.55±8.67

(36.35-71.89)

15

45.45±8.67

(28.11-63.65)

-

33

51

77.27±5.16

(56.30-86.69)

15

22.73±5.16

(13.31-34.70)

66

Башкиры

 

18

41.86±7.52

(27.01-57.87)

23

53.49±7.61

(37.65-68.82)

2

4.65±3.21

(0.57-15.81)

43

59

68.60±5.00

(57.70-78.19)

27

31.40±5.00

(21.82-42.30)

84

 

ЛИТЕРАТУРА:

            1.Гичев Ю.П. //Загрязнение окружающей среды и здоровье человека (Печальный опыт России) , Новосибирск, СО РАМН. - 2002. – 230 с.

            2.Лещенко И.В., Овчаренко С.И, Шмелёв Е.И.// Хроническая обструктивная болезнь. Руководство для врачей/ Федеральная программа.- М.: 2004.-62 с.

3.Чучалин А.Г.// Хронические обструктивные болезни легких. - М.: БИНОМ. – 1999. - 512 c.

            4.Шмелёв Е.И. Хронический обструктивный бронхит // Хроническая обструктивная болезнь лёгких / Под ред. А.Г. Чучалина . М . -1998.- С. 402.

       5.Baranov V.S., Ivaschenko T., Bakay B. et al. Proportion of the GSTM1 0/0 genotipe in some Slavic populations and its correlation with cystic fibrosis and some multifactorial diseases // Hum.Genet.- 1996.- Vol.97. P.516-520.

            6. Bastaki M., Huen K., Manzanillo P., Chande N., Chen C., Balmes J.R., Tager I.B., Holland N. Genotype-activity relationship for Mn-superoxide dismutase, glutathione peroxidase 1 and catalase in humans//Pharmacogenet Genomics. -2006.- Vol.16(4).- P. 279-86.

7. Christiani D.C. Occupation and COPD // Occup. Environ. Med.- 2005.- Vol.62. P. 215.

            8.Kinnula V.L. Focus on antioxidant enzymes and antioxidant strategies in smoking related airway disease // Thorax.- 2005.- Vol. 60. P. 693-700.

            9.Mathew C.C. The isolation of high molecular weight eucariotic DNA // Methods in Molecular Biology. Ed. Walker J.M.. - N.Y., L.: Human Press. - 1984. - Vol. 2. - p. 31.

10.Nadif R., Mintz M., Jedlicka A., Bertrand J.P., Kleeberger S.R., Kauffmann F. Association of CAT polymorphisms with catalase activity and exposure to environmental oxidative stimuli//Free Radic Res.-2005.- Vol. 39(12). P.1345-50.

11.Forsberg L., Lyrenas L., de Faire U., Morgenstern R. A common functional C-T substitution polymorphism in the promoter region of the human catalase gene influences transcription factor binding, reporter gene transcription and is correlated to blood catalase levels// Free Radical Biology and Medicine.- 2001.- Vol.30.- №5.-P. 500-505.

 

Обсуждение

Социальные комментарии Cackle